• Users Online: 57
  • Print this page
  • Email this page


 
 
Table of Contents
ORIGINAL ARTICLE
Year : 2020  |  Volume : 69  |  Issue : 1  |  Page : 1-8

A pilot study of microRNA expression profiles of the spinal neuron in matrix metalloproteinase-9 knockout mice


1 Department of Neurology, The First Affiliated Hospital of Xiamen University, Xiamen; The First Clinical Medical College of Fujian Medical University, Fuzhou, Fujian, China
2 Department of Neurology, The First Affiliated Hospital of Xiamen University, Xiamen, China
3 Medical College of Xiamen University, Xiamen, China

Date of Submission14-Jun-2019
Date of Acceptance16-Jan-2020
Date of Web Publication11-Apr-2020

Correspondence Address:
Dr. Min Bi
Department of Neurology, The First Affiliated Hospital of Xiamen University, 55 Zhenhai Road, Xiamen, 361003 Fujian; The First Clinical Medical College of Fujian Medical University, 20 Chazhong Road, Fuzhou, 350005 Fujian
China
Dr. Suijun Tong
Department of Neurology, The First Affiliated Hospital of Xiamen University, 55 Zhenhai Road, Xiamen, 361003 Fujian; The First Clinical Medical College of Fujian Medical University, 20 Chazhong Road, Fuzhou, 350005 Fujian
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/JASI.JASI_76_19

Rights and Permissions
  Abstract 


Introduction: Matrix metalloproteinase-9 (MMP9) plays a key role in blood–spinal cord barrier dysfunction. MMP9 blockade leads to improved injured locomotor recovery. However, it is still unknown whether MMP9 deficiency affects gene expression or signal transduction pathways in the spinal neuron. Material and Methods: In this study, we first screen the MMP9 knockdown mice with high superoxide dismutase (SOD) expression and low MMP9 expression by polymerase chain reaction analysis. Then, the gene microarrays were used to screen differentially expressed genes in the spinal neuron from MMP-9 knockout and wild-type mice. There were six groups in this experiment, including three negative control groups: SOD_1, SOD_2, and SOD_3, and three experiment groups: SOD_ MMP9_1, SOD_ MMP9_2, and SOD_ MMP9_3. The gene ontology terms were used to predict the potential functions of these differentially expressed genes, and the Kyoto Encyclopedia of Genes and Genomes was used to analyze the potential functions of these target genes in the pathways. Results: We found that the gene expression in the spinal neuron from MMP9 knockout mice was significantly altered compared to wild-type mice. FoxO signaling, axon guidance, ubiquitin-mediated proteolysis, regulation of actin cytoskeleton, and proteoglycans were changed. Discussion and Conclusion: In summary, MMP9 plays a role in spinal neuron signaling and the underlying mechanism may through affecting several signaling pathways.

Keywords: Matrix metalloproteinase-9, microarray analysis, differentially expressed genes, spinal neuron


How to cite this article:
Li J, Jiang B, Zhang Y, Yao R, Duan S, Wang Y, Tong S, Bi M. A pilot study of microRNA expression profiles of the spinal neuron in matrix metalloproteinase-9 knockout mice. J Anat Soc India 2020;69:1-8

How to cite this URL:
Li J, Jiang B, Zhang Y, Yao R, Duan S, Wang Y, Tong S, Bi M. A pilot study of microRNA expression profiles of the spinal neuron in matrix metalloproteinase-9 knockout mice. J Anat Soc India [serial online] 2020 [cited 2020 May 28];69:1-8. Available from: http://www.jasi.org.in/text.asp?2020/69/1/1/282306




  Introduction Top


With an increasing number of traffic accidents, spinal cord injury becomes a serious common clinical disease with high morbidity. The tight junctions of capillaries, basement membrane, and blood-brain barrier were then destructed by matrix metalloproteinase-9 (MMP9).[1] After that, the vasogenic edema in the central nervous system is appearing. Under normal circumstances, MMP9 is expressed in microglia, astrocytes, and hippocampal neurons at a low constitutive level. Moreover, it can be induced in astrocytes, microglia/macrophages, and hippocampal cells in the central nervous system.[2],[3],[4],[5] However, MMP9 increased rapidly in both inflammatory cells and endothelial cells after the spinal cord injury and reached a maximum at 24 h. It may be associated with the abnormal vascular permeability caused by hemorrhagic injury or inflammation.[6],[7] In the past few years, MMP9 was confirmed to play a key role in blood–spinal cord barrier dysfunction.[8] MMP9 blockade leads to improved injured locomotor recovery. The above studies provided insight concerning the effect of MMP9 in the spinal neuron. In this study, to detect the effect of MMP9 on gene expression and signal transduction pathways in the spinal neuron, we chose the mice model with MMP9 knockdown. We first screen the MMP9 knockdown mice in the offspring. The polymerase chain reaction (PCR) analysis was performed on the tail genomic DNA, and the mice with high superoxide dismutase (SOD) expression and low MMP9 expression was chosen as the experiment groups. To identify whether gene expression would be affected by MMP9 deletion, in this study, we used spinal neurons from MMP9 knockout and wild-type mice, screened for differentially expressed genes using microarrays. The gene ontology (GO) terms were used to predict the potential functions of these differentially expressed genes and the Kyoto Encyclopedia of Genes and Genomes (KEGG) was used to analyze the potential functions of these target genes in the pathways. Our results showed that the gene expression in the spinal neuron from MMP9 knockout mice was significantly altered and we predicted that MMP9 plays an important role through affecting several signaling pathways, including FoxO signaling, axon guidance, ubiquitin-mediated proteolysis, regulation of actin cytoskeleton, and proteoglycans.


  Materials And Methods Top


Ethics approval and informed consent

All animals were obtained from TheFirst Affiliated Hospital of Xiamen University (Fujian, China)

Preparation of EGE-LZX-010 knockout mice

EGE-LZX-010 gene is located on the positive strand of chromosome 2, with a total length of about 15.1 KB (NCBI ID: 17395). EGE-LZX-010 knockout mice were prepared using CRISPR/Cas9 (Beijing Biocytogen Co., Ltd). By analyzing the structure of the EGE-LZX-010 gene, two sgRNAs were used to knock out exon1–12 of ege-lzx-010 genes. To ensure the efficiency of the designed Cas9/sgRNA, the target sequences of C57BL/6 mouse tails were amplified by PCR and verified by sequencing, and the primers are shown in [Figure 1]a. Based on the design principle of sgRNA, a total of 14 sgRNA were designed, and the corresponding oligo sequences are shown in [Figure 1]b, and then the Cas9/sgRNA plasmid was constructed, meanwhile, the activity of sgRNA was detected by-UCA. Finally, Cas9-sgRNA was injected embryos to construct the EGE-LZX-010 knockout mice. The injected embryos then developed into F0 generation mice, and the genotype of F0 generation mice was measured by PCR, the primers are shown in [Figure 1]c. F0 generation positive mice were mated with wild type to obtain F1 generation mice with stable genotype, and the genotype of F1 generation mice was also measured by PCR.
Figure 1: The sequences of primers in this study. (a) The primers to detect the target sequences. (b) The oligo sequences of 14 sgRNAs. (c) The primers to detect the genotype of mice

Click here to view


Sampling and DNA purification

Mouse genotypes were verified throughout the study by PCR performed on tail genomic DNA. First, 0.5–1 cm tissue from the tail of mice of each group was ground into powder using liquid nitrogen. The DNA was extracted from each sample using DNA extraction Kit (Generay, GK0121) according to the manufacturer's instructions. The concentration of DNA was determined by measuring the absorbance of each sample at A260/280 using Merinton SMA4000. The DNA with the ratio of A260/A280 between 1.8 and 2.2 was kept for the following the PCR analysis. Extracted DNA was stored in a freezer at 4°C or 20°C.

Polymerase chain reaction procedures

Two pairs of oligonucleotide primers were used to perform the PCR procedures: EGE-LZX-010-5, MSD-F: 5'TGGGGGTCCTGCCTGACTTG3', EGE-LZX-010-3, MSD-R: 5'CAGTCAGAACCTCTGCCCTCCTC3', SOD-F: 5' CAGTCAGAACCTCTGCCCTCCTC 3' and SOD-R: 5' CGC GAC TAA CAA TCA AAG TGA 3'. PCR were performed in a 96-well using a GeneAmp PCR kit (Applied Biosystems, Foster City. CA) in a -25 μL total reaction volumes containing 2.5 μL of PCR buffer 10X (50 mM KCl, 10 mM Tris-HCl [pH = 8.3], 0.1% Triton X-100), 1.0 μL genomic DNA, 1 μL of each primer, 2 μL dNTPs, and 0.5 μL (10U/μL) of Taq DNA polymerase (TaKaRa). GeneAmp PCR System 9700 was used to analyze the result.

Target genes prediction, gene ontology enrichment, and Kyoto Encyclopedia of Genes and Genomes pathway analysis

Differentially expressed microRNAs (miRNAs) were screened with P < 0.05, and the potential target genes were predicted using TargetScan and MiRanda online software. The intersection elements of the two software were accepted as candidate target genes of the differential miRNA. The hierarchical clustering (HCL) was performed to determine the normalized expression level of each RNA type. The predicted target genes were input into the GO database (http://www. geneontology.org/) to execute GO annotation and enrichment analysis from three ontologies: molecular function, cellular component, and biological process. The GO terms were significantly enriched in the predicted target gene candidates of the miRNA compared with the entire gene background. The GO terms with the P ≤ 0.01 are defined as significantly enriched in the target gene candidates. Furthermore, the KEGG database (http://www.genome.ad.jp/kegg/) was used to analyze the potential functions of these target genes in the pathways. The genes with P ≤ 0.5 were considered significantly enriched in target gene candidates.

Statistical analysis

The data were presented as the mean ± standard deviation and analyzed by the Student's t-test and variance (ANOVA) using SPSS 15.0 software (SPSS, Chicago, IL, USA). P < 0.05 was considered statistically significant.


  Results Top


Preparation and identification of EGE-LZX-010 knockout mice

To prepare the EGE-LZX-010 knockout mice by CRISPR/Cas9 (Beijing Biocytogen Co., Ltd), the activities of 14 sgRNA were detected, and the results are shown in [Figure 2]a. Meanwhile, EGE-LZX-010-sgRNA5 and EGE-LZX-010-sgRNA9 were ligated into the T7 promoter plasmid to obtain microinjected RNA. The microinjected RNAs were identified by PCR assay, and the results are shown in [Figure 2]b. In addition, the EGE-LZX-010 knockout mice were obtained by injecting Cas9-sgRNA into embryos. The genotype of F0 generation mice was identified by PCR assay, and the results indicated that EX10-1, EX10-4, EX10-6, EX10-7, EX10-12, and EX10-14 were the positive mice [Figure 3]a, and then the F1 generation mice were obtained by F0 generation positive mice mated with wild type [Figure 3]b. The genotype of F1 generation mice were also identified by PCR assay, and the results indicated that1EX10-9, 1EX10-10, 1EX10-11, 1EX10-13, 1EX10-14, 1EX10-18, 1EX10-19, 1EX10-20, 1EX10-21, 1EX10-22, 1EX10-23, 1EX10-27, and 1EX10-28 were positive heterozygous mice [Figure 3]c.
Figure 2: The activity identification of Cas9/sgRNA.(a) Cas9/sgRNA activity was measured by UCATM. (b) The microinjected RNAs were detected by polymerase chain reaction assay

Click here to view
Figure 3: Detection of mice genotype. (a) The genotype of F0 generation mice was measured by polymerase chain reaction assay. (b) F0 generation positive mice were mated with wild type. (c) The genotype of F1 generation mice was measured by polymerase chain reaction assay

Click here to view


Genotype

We detected the gene MMP9 and SOD expression in the progeny of MMP9 knockout mice by PCR performed on tail genomic DNA and screen mice with high SOD expression and low MMP9 expression. Using a primer pair spanning a sequence of MMP9 gene (EGE-LZX-010) that was knocked out in mice, a 236-bp fragment was generated, but the 600bp fragment was not in line 21 and line 22 [Figure 4]. The experiment was repeated six times, and the results were available in supplement [Figure 1].
Figure 4: Screening mice with high superoxide dismutase expression and low matrix metalloproteinase-9 expression by polymerase chain reaction analysis. matrix metalloproteinase-9 and superoxide dismutase expressions in the progeny of matrix metalloproteinase-9 knockout mice were assessed by polymerase chain reaction assay with mouse tail genomic DNA and a specific primer pair designed from the matrix metalloproteinase-9 gene sequence (EGE-LZX-010). The polymerase chain reaction products were analyzed by 1.5% agarose gel electrophoresis

Click here to view


Differentially expressed genes in the spinal neuron of matrix metalloproteinase-9 knockout mice

In the present study, a total of 58,589 genes were annotated and available in supplement [Table 1]. After preliminary standardized analysis, 3,969 genes were screened [Supplement [Table 2]. A dendrogram of a hierarchical clustering analysis of differentially expressed miRNAs between the SOD mice with and without MMP9 knockout. The different expression of mouse miRNAs at the probe level was showed in the heat map. The expression profiles of 215 mature miRNAs were assessed using miRNA microarrays in SOD mice in the control groups and MMP9 knockout groups [Supplement [Table 3]. Among these, 20 miRNAs were differential expression (17 down-regulated and 3 up-regulated) in the PMM9 knockout group compared to the control group [Figure 5]. Differentially expressed miRNA target gene prediction is listed in [Table 1].
Table 1: Differentially expressed microRNA target gene prediction (partial, P≤0.05)

Click here to view
Figure 5: A hierarchical clustering analysis of differentially expressed miRNAs between the superoxide dismutase-expressed mice with and without matrix metalloproteinase-9 knockout. The heat map showed the expression levels of differentially expressed mouse miRNAs. Heat map colors represented the relative miRNA expression levels as indicated in the color key. The different color indicated different miRNA expression levels. Red indicates the high expression of miRNA and green indicates the low expression of miRNA

Click here to view


Gene ontology annotations analysis of candidate target genes

To understand more about the roles of differentially expressed miRNAs between SOD and SOD_MMP9 groups mice, the differentially expressed genes were assigned to 565031 GO terms, including biological processes, cellular components, and molecular function terms [Supplement [Table 4]. A total of 21754 putative target genes targeted by 13407 differentially expressed miRNAs were selected and submitted to GO enrichment. Among all GO terms, the biggest is GO: 0005737, annotated for 5699 candidate target genes. All candidate target genes were distributed into 1188 GO terms [Supplement [Table 5]. Typical enriched GO terms are shown in [Figure 6]a. We can see that the most enriched biological process term is “regulation of transcription,” “transcription, DNA-templated,” and “transport.” The most enriched cellular component term is “membrane,” “integral component of membrane,” and “cytoplasm.” The most enriched molecular function term is “protein binding,” metal ion binding,” and “nucleotide-biding.” The statistics of the enriched GO categories for the target genes of differentially expressed miRNAs are shown in [Figure 6]b. We can see the most of the genes were located in the membrane and nucleus, related to transport, binding activity, transcription, and transferase activity and other biological functions.
Figure 6: The statistics of gene ontology pathway enrichment. (a) The percent of genes in the gene ontology term was shown in the bar chart of biological processes, cellular components, and molecular functions. (b) Scatterplot of enriched terms showed the statistics of gene ontology enrichment in the spinal neuron of matrix metalloproteinase-9 knockout mice. The circular dots represented the numbers of annotated genes for different gene ontology terms. Different colors represented different levels of significance (P value). The rich factor was a ratio of the gene numbers of each term to the numbers of all genes with terms

Click here to view


Kyoto Encyclopedia of Genes and Genomes pathways analysis of candidate target genes

KEGG database is a collection of various pathways, representing the molecular interactions and reaction networks. To identify signaling pathways involved in the spinal neuron of MMP9 knockdown mice, 42459 differentially expressed genes were submitted to KEGG analysis [Supplement [Table 6]. We found that the differentially expressed genes were significantly enriched in 124 KEGG pathways [Supplement [Table 7]. The top 20 enriched pathways are shown in [Figure 7]. Differentially expressed genes were highly clustered in several signaling pathways, such as ''FoxO signaling,” “Axon guidance,” “Ubiquitin-mediated proteolysis,” “regulation of actin cytoskeleton,” and “Proteoglycans in cancer,” suggesting that MMP9 may perform its function through these pathways.
Figure 7: The selected top enriched pathway terms. Scatterplot of enriched Kyoto Encyclopedia of Genes and Genomes pathway showed the top 20 pathways enriched in the spinal neuron of matrix metalloproteinase-9 knockout mice. A rich factor was the ratio of the differentially expressed gene number to the total gene number in a certain pathway. The color and size of the dots represented the range of the P value and the number of genes to the indicated pathways, respectively. Top 20 enriched pathways were shown in the figure

Click here to view



  Discussion Top


The neurodegenerative disease is a kind of disease characterized by neuronal loss, neuronal dysfunction, and cell death.[9] For example, most motor neurons die in the progress of amyotrophic lateral sclerosis (ALS). SOD1 is a ubiquitously expressed cytosolic metalloenzyme which is closely related to the progressive motor neuron death and is implicated in inherited ALS.[10] Kaplan et al. have confirmed that the increment of SOD1 and reduction of MMP-9 function significantly delayed muscle denervation. Moreover, they suggested that MMP-9 may be a candidate therapeutic target for ALS.[11] In this study, we chose the mice with high SOD expression and low MMP9 expression in the offspring of MMP9 knockdown mice with the PCR analysis. As shown in [Figure 1], a 236-bp fragment was generated, but the 600-bp fragment was not in line 21 and line 22.

MMP-9 is expressed normally in neurons, astrocytes, oligodendrocytes, microglial cells,[12],[13],[14] whereas MMP-9 can additionally be found in inflammatory cells such as macrophages, lymphocytes, neutrophils, and endothelial cells after a spinal cord injury.[15],[16],[17],[18] The MMP-9 activation leads to the degradation of type IV collagenase and destruction of the extracellular matrix. As a result, the increase in microvascular basement membrane permeability, structural changes, blood–brain barrier, or blood-spinal cord barrier damage, edema, and hemorrhage following one by one.[19],[20],[21] The study performed by Noble et al. showed that MMP-9 played an important role in wound remodeling, cell migration, and neurite outgrowth after spinal cord injury.[13] The significantly upregulated expression of MMP-9 is correlated with the dysfunction in blood–spinal barrier integrity and inflammation. To support the pathogenic role for MMP-9 in SCI, MMP-9 null mice were used to the experiment and the result showed that a marked improvement in functional recovery in MMP9 null mice compared to wild-type controls.[13] The inhibition of MMP 9 activity improves recovery, highlighting the beneficial roles of MMP9 following SCI.[22] However, it is still unknown whether MMP9 deficiency affects gene expression or signal transduction pathways in the spinal neuron.

In the previous years, it has been realized that the expression of individual genes in an organism is the result of a network of regulatory genes. Whether MMP-9 inactivation might lead to changes in the expression of related genes in the spinal neuron has not been detected clearly. Because of the characteristics of broad detection range and accuracy, microarrays have been widely used to identify large numbers of differentially expressed genes in the organism. Based on the above research, we confirmed that the microarray combined with knockout mice is an effective strategy to research the mechanism of different genes regulation. In the present study, using MMP 9 knockout mice and wild-type mice as a comparison, differentially expressed genes in the spinal neuron between MMP9 knockdown and SOD mice were identified using microarrays.

The GO and KEGG analyses were used to analyze the potential functions of these target genes in the pathways. It was found that altered expressions of genes included physiological functions such as ion transport, regulation of transcription, as well as those that regulate corresponding signal transduction pathways, such as different signaling pathways, pathways in cancers, biological, and cellular processes. In the previous studies, we know that as a kind of NF-KB-regulated gene, MMPs are closely associated with tumor invasion.[23],[24] The study performed by Forsyth et al. showed that the MMP9 level was closely related to the increase of tumor progression in gliomas and was known as key enzymes for invasion.[25] In addition, Lakka et al. suggested that MMP-9 was also expressed when tumor cells migrate.[26] The data from the present study indicated that when MMP-9 is lost, global gene expression and protein function within the spinal neuron are affected.


  Conclusion Top


The downregulation of MMP9 affected several signaling pathways in spinal neuron signaling, including FoxO signaling, axon guidance, ubiquitin-mediated proteolysis, regulation of actin cytoskeleton, and proteoglycans and these pathways may be underlying mechanism for MMP9 to function in the spinal neuron signaling.

Financial support and sponsorship

This work was financially supported by The Natural Science Foundation of Fujian Province of China (Grant Number: 2015J01547) and the Young and Middle-Aged Key Personnel Training Project of Fujian Province Health System of China (grant number: 2015-ZQN-JC-41).

Supplemental data

[Additional file 1]

[Additional file 2]

[Additional file 3]

[Additional file 4]

[Additional file 5]

[Additional file 6]

[Additional file 7]

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Jang JW, Lee JK, Kim SH. Activation of matrix metalloproteinases-9 after photothrombotic spinal cord injury model in rats. J Korean Neurosurg Soc 2011;50:288-92.  Back to cited text no. 1
    
2.
Backstrom JR, Lim GP, Cullen MJ, Tökés ZA. Matrix metalloproteinase-9 (MMP-9) is synthesized in neurons of the human hippocampus and is capable of degrading the amyloid-beta peptide (1-40). J Neurosci 1996;16:7910-9.  Back to cited text no. 2
    
3.
Cuzner ML, Gveric D, Strand C, Loughlin AJ, Paemen L, Opdenakker G, et al. The expression of tissue-type plasminogen activator, matrix metalloproteases and endogenous inhibitors in the central nervous system in multiple sclerosis: Comparison of stages in lesion evolution. J Neuropathol Exp Neurol 1996;55:1194-204.  Back to cited text no. 3
    
4.
Liu Z, Shipley JM, Vu TH, Zhou X, Diaz LA, Werb Z, et al. Gelatinase B-deficient mice are resistant to experimental bullous pemphigoid. J Exp Med 1998;188:475-82.  Back to cited text no. 4
    
5.
Yong VW, Power C, Forsyth P, Edwards DR. Metalloproteinases in biology and pathology of the nervous system. Nat Rev Neurosci 2001;2:502-11.  Back to cited text no. 5
    
6.
Mun-Bryce S, Rosenberg GA. Gelatinase B modulates selective opening of the blood-brain barrier during inflammation. Am J Physiol 1998;274:R1203-11.  Back to cited text no. 6
    
7.
Rosenberg GA, Dencoff JE, McGuire PG, Liotta LA, Stetler-Stevenson WG. Injury-induced 92-kilodalton gelatinase and urokinase expression in rat brain. Lab Invest 1994;71:417-22.  Back to cited text no. 7
    
8.
Agrawal SM, Lau L, Yong VW. MMPs in the central nervous system: Where the good guys go bad. Semin Cell Dev Biol 2008;19:42-51.  Back to cited text no. 8
    
9.
Saxena S, Caroni P. Selective neuronal vulnerability in neurodegenerative diseases: From stressor thresholds to degeneration. Neuron 2011;71:35-48.  Back to cited text no. 9
    
10.
Turner BJ, Talbot K. Transgenics, toxicity and therapeutics in rodent models of mutant SOD1-mediated familial ALS. Prog Neurobiol 2008;85:94-134.  Back to cited text no. 10
    
11.
Kaplan A, Spiller KJ, Towne C, Kanning KC, Choe GT, Geber A, et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron 2014;81:333-48.  Back to cited text no. 11
    
12.
Lee SR, Tsuji K, Lee SR, Lo EH. Role of matrix metalloproteinases in delayed neuronal damage after transient global cerebral ischemia. J Neurosci 2004;24:671-8.  Back to cited text no. 12
    
13.
Noble LJ, Donovan F, Igarashi T, Goussev S, Werb Z. Matrix metalloproteinases limit functional recovery after spinal cord injury by modulation of early vascular events. J Neurosci 2002;22:7526-35.  Back to cited text no. 13
    
14.
Planas AM, Solé S, Justicia C. Expression and activation of matrix metalloproteinase-2 and -9 in rat brain after transient focal cerebral ischemia. Neurobiol Dis 2001;8:834-46.  Back to cited text no. 14
    
15.
Hibbs MS, Hoidal JR, Kang AH. Expression of a metalloproteinase that degrades native type V collagen and denatured collagens by cultured human alveolar macrophages. J Clin Invest 1987;80:1644-50.  Back to cited text no. 15
    
16.
Mainardi CL, Hibbs MS, Hasty KA, Seyer JM. Purification of a type V collagen degrading metalloproteinase from rabbit alveolar macrophages. Coll Relat Res 1984;4:479-92.  Back to cited text no. 16
    
17.
Murphy G, Ward R, Hembry RM, Reynolds JJ, Kühn K, Tryggvason K. Characterization of gelatinase from pig polymorphonuclear leucocytes. A metalloproteinase resembling tumour type IV collagenase. Biochem J 1989;258:463-72.  Back to cited text no. 17
    
18.
Wilhelm SM, Collier IE, Marmer BL, Eisen AZ, Grant GA, Goldberg GI. SV40-transformed human lung fibroblasts secrete a 92-kDa type IV collagenase which is identical to that secreted by normal human macrophages. J Biol Chem 1989;264:17213-21.  Back to cited text no. 18
    
19.
Winkler EA, Sengillo JD, Bell RD, Wang J, Zlokovic BV. Blood-spinal cord barrier pericyte reductions contribute to increased capillary permeability. J Cereb Blood Flow Metab 2012;32:1841-52.  Back to cited text no. 19
    
20.
Allen EA, Erhardt EB, Calhoun VD. Data visualization in the neurosciences: Overcoming the curse of dimensionality. Neuron 2012;74:603-8.  Back to cited text no. 20
    
21.
Hasturk A, Atalay B, Calisaneller T, Ozdemir O, Oruckaptan H, Altinors N. Analysis of serum pro-inflammatory cytokine levels after rat spinal cord ischemia/reperfusion injury and correlation with tissue damage. Turk Neurosurg 2009;19:353-9.  Back to cited text no. 21
    
22.
Duchossoy Y, Horvat JC, Stettler O. MMP-related gelatinase activity is strongly induced in scar tissue of injured adult spinal cord and forms pathways for ingrowing neurites. Mol Cell Neurosci 2001;17:945-56.  Back to cited text no. 22
    
23.
Wu JT, Kral JG. The NF-kappaB/IkappaB signaling system: A molecular target in breast cancer therapy. J Surg Res 2005;123:158-69.  Back to cited text no. 23
    
24.
Rao JS. Molecular mechanisms of glioma invasiveness: The role of proteases. Nat Rev Cancer 2003;3:489-501.  Back to cited text no. 24
    
25.
Forsyth PA, Wong H, Laing TD, Rewcastle NB, Morris DG, Muzik H, et al. Gelatinase-A (MMP-2), gelatinase-B (MMP-9) and membrane type matrix metalloproteinase-1 (MT1-MMP) are involved in different aspects of the pathophysiology of malignant gliomas. Br J Cancer 1999;79:1828-35.  Back to cited text no. 25
    
26.
Lakka SS, Rajan M, Gondi C, Yanamandra N, Chandrasekar N, Jasti SL, et al. Adenovirus-mediated expression of antisense MMP-9 in glioma cells inhibits tumor growth and invasion. Oncogene 2002;21:8011-9.  Back to cited text no. 26
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7]
 
 
    Tables

  [Table 1]



 

Top
 
  Search
 
    Similar in PUBMED
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Materials And Me...
Results
Discussion
Conclusion
Introduction
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed237    
    Printed0    
    Emailed0    
    PDF Downloaded72    
    Comments [Add]    

Recommend this journal